RAB10

Plasmid
pFastbac GST6P1 sumostar Rab10 M1-W195
Parent Plasmid
pFastbac GST6P1 sumostar
Expressed
GST sumostar RAB10 M1 - W195
DU Number
DU27856
Tag
GST
SUMO
Species
Human
Sequence of Insert
ATGGCGAAGAAGACGTACGACCTGCTTTTCAAGCTGCTCCTGATCGGGGATTCCGGAGTGGGGAAGACCTGCGTCCTTTTTCGTTTTTCGGATGATGCCTTCAATACTACCTTTATTTCCACCATAGGAATAGACTTCAAGATCAAAACAGTTGAATTACAAGGAAAGAAGATCAAGCTACAGATATGGGATACAGCAGGCCAGGAGCGATTTCACACCATCACAACCTCCTACTACAGAGGCGCAATGGGTATCATGCTAGTATATGACATCACCAATGGTAAAAGTTTTGAAAACATCAGCAAATGGCTTAGAAACATAGATGAGCATGCCAATGAAGATGTGGAAAGAATGTTACTAGGAAACAAGTGTGATATGGACGACAAAAGAGTTGTACCTAAAGGAAAAGGAGAACAGATTGCAAGGGAGCATGGTATTAGGTTTTTTGAGACTAGTGCAAAAGCAAATATAAACATCGAAAAGGCGTTCCTCACGTTAGCTGAAGATATCCTTCGAAAGACCCCTGTAAAAGAGCCCAACAGTGAAAATGTAGATATCAGCAGTGGAGGAGGCGTGACAGGCTGGTGAGCGGCCGC
Amino Acid Sequence
MSPILGYWKIKGLVQPTRLLLEYLEEKYEEHLYERDEGDKWRNKKFELGLEFPNLPYYIDGDVKLTQSMAIIRYIADKHNMLGGCPKERAEISMLEGAVLDIRYGVSRIAYSKDFETLKVDFLSKLPEMLKMFEDRLCHKTYLNGDHVTHPDFMLYDALDVVLYMDPMCLDAFPKLVCFKKRIEAIPQIDKYLKSSKYIAWPLQGWQATFGGGDHPPKSDLEVLFQGPLGSMSDQEAKPSTEDLGDKKEGEYIKLKVIGQDSSEIHFKVKMTTHLKKLKESYCQRQGVPMNSLTFLFEGQEIADNHTPKELGMEEEDVIEVYQEQTGGMAKKTYDLLFKLLLIGDSGVGKTCVLFRFSDDAFNTTFISTIGIDFKIKTVELQGKKIKLQIWDTAGQERFHTITTSYYRGAMGIMLVYDITNGKSFENISKWLRNIDEHANEDVERMLLGNKCDMDDKRVVPKGKGEQIAREHGIRFFETSAKANINIEKAFLTLAEDILRKTPVKEPNSENVDISSGGGVTGW*
Vector Type
Baculovirus
Antibiotic
Amp
Comments
Linker after SENP cleavage deleted to make clone flush
100042 R 1000 1001 1047 19007
Enquire Now