RAB43

Synonyms
RAB11B, RAB41
Plasmid
pX335 RAB43 Nter KI AntiSense B
Parent Plasmid
pX335
Expressed
RAB43 N-Term Nter KI AntiSense B Guide + Cas9n
DU Number
DU60013
Genbank
ENSG00000172780
Species
Human
Sequence of Insert
GCGTCCGGGTCCCCCGGGCCT
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR Nter KI guide, use in conjunction with 60009 and a suitable donor.
100042 R 1000 1001 1047 19007
Enquire Now