RAB12

Plasmid
RAB12 Nter KI G3
Expressed
RAB12 Nter KI G3 Single Vector + Cas9
DU Number
DU64713
Genbank
ENSG00000206418
Species
Human
Sequence of Insert
GCCGCATGCGTGTATGGATCC

Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR KI guide, single vector system expressing spCas9 and puro. Use in conjunction with a suitable donor.
100042 R 1000 1001 1047 19007
Enquire Now