RAB10

Plasmid
pET15b twin strep Sumo Rab10
Parent Plasmid
pET15b 6His SUMO
Expressed
Twin strep sumo Rab10
DU Number
DU62522
Tag
SUMO
StrepII
Species
Human
Sequence of Insert
ATGGCGAAGAAGACGTACGACCTGCTTTTCAAGCTGCTCCTGATCGGGGATTCCGGAGTGGGGAAGACCTGCGTCCTTTTTCGTTTTTCGGATGATGCCTTCAATACTACCTTTATTTCCACCATAGGAATAGACTTCAAGATCAAAACAGTTGAATTACAAGGAAAGAAGATCAAGCTACAGATATGGGATACAGCAGGCCAGGAGCGATTTCACACCATCACAACCTCCTACTACAGAGGCGCAATGGGTATCATGCTAGTATATGACATCACCAATGGTAAAAGTTTTGAAAACATCAGCAAATGGCTTAGAAACATAGATGAGCATGCCAATGAAGATGTGGAAAGAATGTTACTAGGAAACAAGTGTGATATGGACGACAAAAGAGTTGTACCTAAAGGAAAAGGAGAACAGATTGCAAGGGAGCATGGTATTAGGTTTTTTGAGACTAGTGCAAAAGCAAATATAAACATCGAAAAGGCGTTCCTCACGTTAGCTGAAGATATCCTTCGAAAGACCCCTGTAAAAGAGCCCAACAGTGAAAATGTAGATATCAGCAGTGGAGGAGGCGTGACAGGCTGGAAGAGCAAATGCTGCTGAGCGGCCGC
Amino Acid Sequence
MWSHPQFEKGGGSGGGSAWSHPQFEKSDQEAKPSTEDLGDKKEGEYIKLKVIGQDSSEIHFKVKMTTHLKKLKESYCQRQGVPMNSLRFLFEGQRIADNHTPKELGMEEEDVIEVYQEQTGGMAKKTYDLLFKLLLIGDSGVGKTCVLFRFSDDAFNTTFISTIGIDFKIKTVELQGKKIKLQIWDTAGQERFHTITTSYYRGAMGIMLVYDITNGKSFENISKWLRNIDEHANEDVERMLLGNKCDMDDKRVVPKGKGEQIAREHGIRFFETSAKANINIEKAFLTLAEDILRKTPVKEPNSENVDISSGGGVTGWKSKCC*
Vector Type
Bacterial
Antibiotic
Amp
Comments
Linker deleted after SENP cleavage to make clone flush
100042 R 1000 1001 1047 19007
Enquire Now