VPS26A

Plasmid
pLVX Hygro VPS26A
Parent Plasmid
pLVX Hygro
Expressed
VPS26A
DU Number
DU62332
Genbank
NM_001318945
Species
Human
Sequence of Insert
CTCGAGATGAGTTTTCTTGGAGGCTTTTTTGGTCCAATTTGTGAGATCGATATTGTTCTTAATGATGGGGAAACCAGGAAAATGGCAGAAATGAAAACTGAAGATGGCAAAGTAGAAAAACACTATCTCTTCTATGACGGAGAATCCGTTTCAGGAAAGGTAAACCTAGCCTTTAAGCAACCTGGAAAGAGGCTAGAACACCAAGGAATTAGAATTGAATTTGTAGGTCAAATTGAACTTTTCAATGACAAGAGTAATACTCATGAATTTGTAAACCTAGTGAAAGAACTAGCCTTACCTGGAGAACTGACTCAGAGCAGAAGTTATGATTTTGAATTTATGCAAGTTGAAAAGCCATATGAATCTTACATCGGTGCCAATGTCCGCTTGAGGTATTTTCTTAAAGTGACAATAGTGAGAAGACTGACAGATTTGGTAAAAGAGTATGATCTTATTGTTCACCAGCTTGCCACCTATCCTGATGTTAACAACTCTATTAAGATGGAAGTGGGCATTGAAGATTGTCTACATATAGAATTTGAATATAATAAATCAAAGTATCATTTAAAGGATGTGATTGTTGGAAAAATTTACTTCTTATTAGTAAGAATAAAAATACAACATATGGAGTTACAGCTGATCAAAAAAGAGATCACAGGAATTGGACCCAGTACCACAACAGAAACAGAAACAATCGCCAAATATGAAATAATGGATGGTGCACCAGTAAAAGGTGAATCAATTCCAATAAGGCTATTTTTAGCAGGATATGACCCAACTCCAACAATGAGAGATGTGAACAAAAAATTTTCAGTAAGGTACTTTTTGAATTTAGTGCTTGTTGATGAGGAAGACCGGAGGTACTTCAAACAGCAGGAGATAATTTTATGGAGAAAAGCTCCTGAAAAACTGAGGAAACAGAGAACAAACTTTCACCAGCGATTTGAATCTCCAGAATCACAGGCATCTGCCGAACAGCCTGAAATGTGAGGATCC
Amino Acid Sequence
MSFLGGFFGPICEIDIVLNDGETRKMAEMKTEDGKVEKHYLFYDGESVSGKVNLAFKQPGKRLEHQGIRIEFVGQIELFNDKSNTHEFVNLVKELALPGELTQSRSYDFEFMQVEKPYESYIGANVRLRYFLKVTIVRRLTDLVKEYDLIVHQLATYPDVNNSIKMEVGIEDCLHIEFEYNKSKYHLKDVIVGKIYFLLVRIKIQHMELQLIKKEITGIGPSTTTETETIAKYEIMDGAPVKGESIPIRLFLAGYDPTPTMRDVNKKFSVRYFLNLVLVDEEDRRYFKQQEIILWRKAPEKLRKQRTNFHQRFESPESQASAEQPEM*
Vector Type
Mammalian
Antibiotic
Amp
100042 R 1000 1001 1047 19007
Enquire Now