VPS26B

Plasmid
pLVX Hygro vPS26B
Parent Plasmid
pLVX Hygro
Expressed
VPS26B
DU Number
DU62331
Genbank
NM_052875
Species
Human
Sequence of Insert
CTCGAGATGAGCTTCTTCGGCTTCGGGCAGAGCGTGGAGGTGGAAATCCTTCTGAACGATGCAGAGAGTAGGAAGCGGGCCGAGCACAAGACGGAGGACGGGAAGAAGGAGAAATATTTCCTCTTCTACGACGGGGAGACGGTCTCCGGGAAGGTGAGCCTTGCCCTCAAGAACCCCAACAAGCGGCTGGAGCACCAGGGCATCAAGATCGAGTTCATCGGGCAGATCGAACTCTACTACGATCGCGGGAACCACCATGAGTTTGTGTCCCTGGTGAAGGACCTGGCCCGGCCTGGAGAGATCACCCAGTCGCAGGCCTTCGACTTTGAGTTTACCCACGTGGAGAAGCCGTATGAGTCCTACACAGGGCAGAATGTGAAGCTACGCTATTTCCTTCGTGCTACCATCAGCCGCCGCCTCAATGATGTTGTCAAAGAGATGGACATTGTAGTTCACACACTCAGCACATACCCAGAGCTGAACTCTTCCATCAAGATGGAGGTTGGGATTGAGGACTGTCTGCACATTGAATTTGAGTACAATAAATCCAAATACCACTTGAAAGATGTCATTGTAGGGAAGATATACTTCCTGCTGGTGAGAATCAAAATCAAGCACATGGAGATAGACATCATCAAGCGAGAAACGACGGGTACAGGCCCCAACGTGTACCATGAGAATGACACGATAGCCAAGTACGAGATCATGGACGGGGCACCAGTGCGAGGAGAGTCCATCCCGATCCGGCTCTTCCTGGCCGGGTATGAGCTCACGCCCACCATGCGGGACATCAACAAGAAGTTCTCTGTGCGCTATTACCTCAACCTGGTGCTGATAGACGAGGAGGAGCGGCGCTACTTCAAGCAGCAGGAAGTGGTGTTGTGGCGGAAGGGTGACATCGTACGGAAGAGCATGTCCCACCAGGCGGCCATCGCCTCACAGCGCTTTGAGGGCACCACCTCCCTGGGTGAGGTGCGGACCCCCAGCCAGCTGTCTGACAACAACTGCAGGCAGTAGGGATCC
Amino Acid Sequence
MSFFGFGQSVEVEILLNDAESRKRAEHKTEDGKKEKYFLFYDGETVSGKVSLALKNPNKRLEHQGIKIEFIGQIELYYDRGNHHEFVSLVKDLARPGEITQSQAFDFEFTHVEKPYESYTGQNVKLRYFLRATISRRLNDVVKEMDIVVHTLSTYPELNSSIKMEVGIEDCLHIEFEYNKSKYHLKDVIVGKIYFLLVRIKIKHMEIDIIKRETTGTGPNVYHENDTIAKYEIMDGAPVRGESIPIRLFLAGYELTPTMRDINKKFSVRYYLNLVLIDEEERRYFKQQEVVLWRKGDIVRKSMSHQAAIASQRFEGTTSLGEVRTPSQLSDNNCRQ*
Vector Type
Mammalian
Antibiotic
Amp
100042 R 1000 1001 1047 19007
Enquire Now