VPS26B

Plasmid
pMEX3C VPS26B
Parent Plasmid
pMEX3C
Expressed
MBP-VPS26B
DU Number
DU62362
Tag
MBP
Species
Human
Sequence of Insert
CTGGGATCCATGAGCTTCTTCGGCTTCGGGCAGAGCGTGGAGGTGGAAATCCTTCTGAACGATGCAGAGAGTAGGAAGCGGGCCGAGCACAAGACGGAGGACGGGAAGAAGGAGAAATATTTCCTCTTCTACGACGGGGAGACGGTCTCCGGGAAGGTGAGCCTTGCCCTCAAGAACCCCAACAAGCGGCTGGAGCACCAGGGCATCAAGATCGAGTTCATCGGGCAGATCGAACTCTACTACGATCGCGGGAACCACCATGAGTTTGTGTCCCTGGTGAAGGACCTGGCCCGGCCTGGAGAGATCACCCAGTCGCAGGCCTTCGACTTTGAGTTTACCCACGTGGAGAAGCCGTATGAGTCCTACACAGGGCAGAATGTGAAGCTACGCTATTTCCTTCGTGCTACCATCAGCCGCCGCCTCAATGATGTTGTCAAAGAGATGGACATTGTAGTTCACACACTCAGCACATACCCAGAGCTGAACTCTTCCATCAAGATGGAGGTTGGGATTGAGGACTGTCTGCACATTGAATTTGAGTACAATAAATCCAAATACCACTTGAAAGATGTCATTGTAGGGAAGATATACTTCCTGCTGGTGAGAATCAAAATCAAGCACATGGAGATAGACATCATCAAGCGAGAAACGACGGGTACAGGCCCCAACGTGTACCATGAGAATGACACGATAGCCAAGTACGAGATCATGGACGGGGCACCAGTGCGAGGAGAGTCCATCCCGATCCGGCTCTTCCTGGCCGGGTATGAGCTCACGCCCACCATGCGGGACATCAACAAGAAGTTCTCTGTGCGCTATTACCTCAACCTGGTGCTGATAGACGAGGAGGAGCGGCGCTACTTCAAGCAGCAGGAAGTGGTGTTGTGGCGGAAGGGTGACATCGTACGGAAGAGCATGTCCCACCAGGCGGCCATCGCCTCACAGCGCTTTGAGGGCACCACCTCCCTGGGTGAGGTGCGGACCCCCAGCCAGCTGTCTGACAACAACTGCAGGCAGTAGGCGGCCGC

Amino Acid Sequence
MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELVKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTNSSSNNNNNNNNNNLGDDDDKVPEFLEVLFQGPLGSMSFFGFGQSVEVEILLNDAESRKRAEHKTEDGKKEKYFLFYDGETVSGKVSLALKNPNKRLEHQGIKIEFIGQIELYYDRGNHHEFVSLVKDLARPGEITQSQAFDFEFTHVEKPYESYTGQNVKLRYFLRATISRRLNDVVKEMDIVVHTLSTYPELNSSIKMEVGIEDCLHIEFEYNKSKYHLKDVIVGKIYFLLVRIKIKHMEIDIIKRETTGTGPNVYHENDTIAKYEIMDGAPVRGESIPIRLFLAGYELTPTMRDINKKFSVRYYLNLVLIDEEERRYFKQQEVVLWRKGDIVRKSMSHQAAIASQRFEGTTSLGEVRTPSQLSDNNCRQ*
Vector Type
Bacterial
Antibiotic
Amp
100042 R 1000 1001 1047 19007
Enquire Now