VPS26B

Plasmid
pGEX6P1 VPS26B
Parent Plasmid
pGEX6P1
Expressed
GST-VPS26B
DU Number
DU62361
Tag
GST
Species
Human
Sequence of Insert
GGATCCATGAGCTTCTTCGGCTTCGGGCAGAGCGTGGAGGTGGAAATCCTTCTGAACGATGCAGAGAGTAGGAAGCGGGCCGAGCACAAGACGGAGGACGGGAAGAAGGAGAAATATTTCCTCTTCTACGACGGGGAGACGGTCTCCGGGAAGGTGAGCCTTGCCCTCAAGAACCCCAACAAGCGGCTGGAGCACCAGGGCATCAAGATCGAGTTCATCGGGCAGATCGAACTCTACTACGATCGCGGGAACCACCATGAGTTTGTGTCCCTGGTGAAGGACCTGGCCCGGCCTGGAGAGATCACCCAGTCGCAGGCCTTCGACTTTGAGTTTACCCACGTGGAGAAGCCGTATGAGTCCTACACAGGGCAGAATGTGAAGCTACGCTATTTCCTTCGTGCTACCATCAGCCGCCGCCTCAATGATGTTGTCAAAGAGATGGACATTGTAGTTCACACACTCAGCACATACCCAGAGCTGAACTCTTCCATCAAGATGGAGGTTGGGATTGAGGACTGTCTGCACATTGAATTTGAGTACAATAAATCCAAATACCACTTGAAAGATGTCATTGTAGGGAAGATATACTTCCTGCTGGTGAGAATCAAAATCAAGCACATGGAGATAGACATCATCAAGCGAGAAACGACGGGTACAGGCCCCAACGTGTACCATGAGAATGACACGATAGCCAAGTACGAGATCATGGACGGGGCACCAGTGCGAGGAGAGTCCATCCCGATCCGGCTCTTCCTGGCCGGGTATGAGCTCACGCCCACCATGCGGGACATCAACAAGAAGTTCTCTGTGCGCTATTACCTCAACCTGGTGCTGATAGACGAGGAGGAGCGGCGCTACTTCAAGCAGCAGGAAGTGGTGTTGTGGCGGAAGGGTGACATCGTACGGAAGAGCATGTCCCACCAGGCGGCCATCGCCTCACAGCGCTTTGAGGGCACCACCTCCCTGGGTGAGGTGCGGACCCCCAGCCAGCTGTCTGACAACAACTGCAGGCAGTAGGCGGCCGC

Amino Acid Sequence
MSPILGYWKIKGLVQPTRLLLEYLEEKYEEHLYERDEGDKWRNKKFELGLEFPNLPYYIDGDVKLTQSMAIIRYIADKHNMLGGCPKERAEISMLEGAVLDIRYGVSRIAYSKDFETLKVDFLSKLPEMLKMFEDRLCHKTYLNGDHVTHPDFMLYDALDVVLYMDPMCLDAFPKLVCFKKRIEAIPQIDKYLKSSKYIAWPLQGWQATFGGGDHPPKSDLEVLFQGPLGSMSFFGFGQSVEVEILLNDAESRKRAEHKTEDGKKEKYFLFYDGETVSGKVSLALKNPNKRLEHQGIKIEFIGQIELYYDRGNHHEFVSLVKDLARPGEITQSQAFDFEFTHVEKPYESYTGQNVKLRYFLRATISRRLNDVVKEMDIVVHTLSTYPELNSSIKMEVGIEDCLHIEFEYNKSKYHLKDVIVGKIYFLLVRIKIKHMEIDIIKRETTGTGPNVYHENDTIAKYEIMDGAPVRGESIPIRLFLAGYELTPTMRDINKKFSVRYYLNLVLIDEEERRYFKQQEVVLWRKGDIVRKSMSHQAAIASQRFEGTTSLGEVRTPSQLSDNNCRQ*
Vector Type
Bacterial
Antibiotic
Amp
100042 R 1000 1001 1047 19007
Enquire Now