Rab38

Plasmid
pGEX6P1 6HIS SUMO RAB38
Parent Plasmid
pGEX6P1 6His sumo
Expressed
GST 6HIS SUMO Rab38
DU Number
DU27491
Tag
GST
6His
SUMO
Species
Human
Sequence of Insert
GGATCCATGCAGGCCCCGCACAAGGAGCACCTGTACAAGTTGCTGGTGATTGGCGACCTGGGCGTGGGGAAGACCAGTATCATCAAGCGCTACGTGCACCAGAACTTCTCTTCGCACTACCGGGCCACAATCGGCGTGGACTTCGCGCTCAAGGTGCTCCACTGGGACCCGGAGACTGTGGTGCGCCTGCAGCTCTGGGATATCGCAGGTCAAGAAAGATTTGGAAACATGACGAGGGTCTATTACCGAGAAGCTATGGGTGCATTTATTGTCTTCGATGTCACCAGGCCAGCCACATTTGAAGCAGTGGCAAAGTGGAAAAATGATTTGGACTCCAAGTTAAGTCTCCCTAATGGCAAACCGGTTTCAGTGGTTTTGTTGGCCAACAAATGTGACCAGGGGAAGGATGTGCTCATGAACAATGGCCTCAAGATGGACCAGTTCTGCAAGGAGCACGGTTTCGTAGGATGGTTTGAAACATCAGCAAAGGAAAATATAAACATTGATGAAGCCTCCAGATGCCTGGTGAAACACATACTTGCAAATGAGTGTGACCTAATGGAGTCTATTGAGCCGGACGTCGTGAAGCCCCATCTCACATCAACCAAGGTTGCCAGCTGCTCTGGCTGTGCCAAATCCTAGGCGGCCGC
Amino Acid Sequence
MSPILGYWKIKGLVQPTRLLLEYLEEKYEEHLYERDEGDKWRNKKFELGLEFPNLPYYIDGDVKLTQSMAIIRYIADKHNMLGGCPKERAEISMLEGAVLDIRYGVSRIAYSKDFETLKVDFLSKLPEMLKMFEDRLCHKTYLNGDHVTHPDFMLYDALDVVLYMDPMCLDAFPKLVCFKKRIEAIPQIDKYLKSSKYIAWPLQGWQATFGGGDHPPKSDLEVLFQGPLGSMGHHHHHHSDQEAKPSTEDLGDKKEGEYIKLKVIGQDSSEIHFKVKMTTHLKKLKESYCQRQGVPMNSLRFLFEGQRIADNHTPKELGMEEEDVIEVYQEQTGGGSMQAPHKEHLYKLLVIGDLGVGKTSIIKRYVHQNFSSHYRATIGVDFALKVLHWDPETVVRLQLWDIAGQERFGNMTRVYYREAMGAFIVFDVTRPATFEAVAKWKNDLDSKLSLPNGKPVSVVLLANKCDQGKDVLMNNGLKMDQFCKEHGFVGWFETSAKENINIDEASRCLVKHILANECDLMESIEPDVVKPHLTSTKVASCSGCAKS*
Vector Type
Bacterial
Antibiotic
Amp
Comments
Needs linker after SENP cleavage deleted to make it flush
100042 R 1000 1001 1047 19007
Enquire Now