RAB10

Plasmid
pET15b 6HIS RAB10 M1-P175
Parent Plasmid
pET15b 6His
Expressed
6HIS RAB10 M1 - P175
DU Number
DU27497
Tag
6His
Species
Human
Sequence of Insert
GGATCCATGGCGAAGAAGACGTACGACCTGCTTTTCAAGCTGCTCCTGATCGGGGATTCCGGAGTGGGGAAGACCTGCGTCCTTTTTCGTTTTTCGGATGATGCCTTCAATACTACCTTTATTTCCACCATAGGAATAGACTTCAAGATCAAAACAGTTGAATTACAAGGAAAGAAGATCAAGCTACAGATATGGGATACAGCAGGCCAGGAGCGATTTCACACCATCACAACCTCCTACTACAGAGGCGCAATGGGTATCATGCTAGTATATGACATCACCAATGGTAAAAGTTTTGAAAACATCAGCAAATGGCTTAGAAACATAGATGAGCATGCCAATGAAGATGTGGAAAGAATGTTACTAGGAAACAAGTGTGATATGGACGACAAAAGAGTTGTACCTAAAGGAAAAGGAGAACAGATTGCAAGGGAGCATGGTATTAGGTTTTTTGAGACTAGTGCAAAAGCAAATATAAACATCGAAAAGGCGTTCCTCACGTTAGCTGAAGATATCCTTCGAAAGACCCCTTGAGCGGCCGC
Amino Acid Sequence
MGSSHHHHHHSSGLEVLFQGPGSMAKKTYDLLFKLLLIGDSGVGKTCVLFRFSDDAFNTTFISTIGIDFKIKTVELQGKKIKLQIWDTAGQERFHTITTSYYRGAMGIMLVYDITNGKSFENISKWLRNIDEHANEDVERMLLGNKCDMDDKRVVPKGKGEQIAREHGIRFFETSAKANINIEKAFLTLAEDILRKTP*
Vector Type
Bacterial
Antibiotic
Amp
100042 R 1000 1001 1047 19007
Enquire Now