Rab32

Plasmid
pET15b 6HIS SUMO RAB32 M91S R93S
Parent Plasmid
pET15b 6His SUMO
Expressed
6HIS SUMO Rab32 M91S R93S
DU Number
DU27242
Tag
6His
SUMO
Species
Human
Sequence of Insert
GGATCCATGGCGGGCGGAGGAGCCGGGGACCCCGGCCTGGGGGCGGCCGCCGCCCCAGCGCCCGAGACCCGCGAGCACCTCTTCAAGGTGCTGGTGATCGGCGAGCTTGGCGTGGGCAAGACCAGCATCATCAAGCGCTACGTCCACCAGCTCTTCTCCCAGCACTACCGGGCCACCATCGGGGTGGACTTCGCCCTCAAGGTCCTCAACTGGGACAGCAGGACTCTGGTGCGCCTGCAGCTGTGGGACATCGCGGGGCAGGAGCGATTTGGCAACTCTACCTCAGTATACTACAAGGAAGCTGTTGGTGCTTTTGTAGTCTTTGATATATCAAGAAGTTCCACATTTGAGGCAGTCTTAAAATGGAAAAGTGATCTGGATAGTAAAGTTCATCTTCCAAATGGCAGCCCTATCCCTGCTGTCCTCTTGGCTAACAAATGTGACCAGAACAAGGACAGTAGCCAGAGTCCTTCCCAGGTGGACCAATTCTGCAAAGAACATGGCTTTGCCGGATGGTTTGAAACCTCTGCAAAGGATAACATAAACATAGAGGAAGCTGCCCGGTTCCTAGTGGAGAAGATTCTTGTAAACCACCAAAGCTTTCCTAATGAAGAAAACGATGTGGACAAAATTAAGCTAGATCAAGAGACCTTGAGAGCAGAGAACAAATCCCAGTGTTGCTGACGGCCGCGTAAGGGCGAATTCCACAGTGGATATCAAGCTTATCGATACCGTCGAC
Amino Acid Sequence
MGHHHHHHSDQEAKPSTEDLGDKKEGEYIKLKVIGQDSSEIHFKVKMTTHLKKLKESYCQRQGVPMNSLRFLFEGQRIADNHTPKELGMEEEDVIEVYQEQTGGSMAGGGAGDPGLGAAAAPAPETREHLFKVLVIGELGVGKTSIIKRYVHQLFSQHYRATIGVDFALKVLNWDSRTLVRLQLWDIAGQERFGNSTSVYYKEAVGAFVVFDISRSSTFEAVLKWKSDLDSKVHLPNGSPIPAVLLANKCDQNKDSSQSPSQVDQFCKEHGFAGWFETSAKDNINIEEAARFLVEKILVNHQSFPNEENDVDKIKLDQETLRAENKSQCC*
Vector Type
Bacterial
Antibiotic
Amp
Comments
Clone still has linker after SENP cleavage. Original clone 52634 still has it aswell.
100042 R 1000 1001 1047 19007
Enquire Now