RAB8A

Plasmid
pMEX 6HIS SUMO Rab8A
Parent Plasmid
pMEX 6HIS SUMO
Expressed
MBP 6HIS SUMO RAB8A
DU Number
DU26908
Tag
6His
MBP
SUMO
Species
Human
Sequence of Insert
GGATCCATGGCGAAGACCTACGATTACCTGTTCAAGCTGCTGCTGATCGGGGACTCGGGGGTGGGGAAGACCTGTGTCCTGTTCCGCTTCTCCGAGGACGCCTTCAACTCCACTTTTATCTCCACCATAGGAATTGACTTTAAAATTAGGACCATAGAGCTCGATGGCAAGAGAATTAAACTGCAGATATGGGACACAGCCGGTCAGGAACGGTTTCGGACGATCACAACGGCCTACTACAGGGGTGCAATGGGCATCATGCTGGTCTACGACATCACCAACGAGAAGTCCTTCGACAACATCCGGAACTGGATTCGCAACATTGAGGAGCACGCCTCTGCAGACGTCGAAAAGATGATACTCGGGAACAAGTGTGATGTGAATGACAAGAGACAAGTTTCCAAGGAACGGGGAGAAAAGCTGGCCCTCGACTATGGAATCAAGTTCATGGAGACCAGCGCGAAGGCCAACATCAATGTGGAAAATGCATTTTTCACTCTCGCCAGAGATATCAAAGCAAAAATGGACAAAAAATTGGAAGGCAACAGCCCCCAGGGGAGCAACCAGGGAGTCAAAATCACACCGGACCAGCAGAAGAGGAGCAGCTTTTTCCGATGTGTTCTTCTGTGAGCGGCCGC
Amino Acid Sequence
MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELVKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTNSSSNNNNNNNNNNLGDDDDKVPEFLEVLFQGPGSMGHHHHHHSDQEAKPSTEDLGDKKEGEYIKLKVIGQDSSEIHFKVKMTTHLKKLKESYCQRQGVPMNSLRFLFEGQRIADNHTPKELGMEEEDVIEVYQEQTGGMAKTYDYLFKLLLIGDSGVGKTCVLFRFSEDAFNSTFISTIGIDFKIRTIELDGKRIKLQIWDTAGQERFRTITTAYYRGAMGIMLVYDITNEKSFDNIRNWIRNIEEHASADVEKMILGNKCDVNDKRQVSKERGEKLALDYGIKFMETSAKANINVENAFFTLARDIKAKMDKKLEGNSPQGSNQGVKITPDQQKRSSFFRCVLL*
Vector Type
Bacterial
Antibiotic
Amp
Comments
linker after SENP cleavage deleted
100042 R 1000 1001 1047 19007
Enquire Now