Rab10

Plasmid
pCMV5D Rab10
Parent Plasmid
pCMV5D
Expressed
Rab10
DU Number
DU26858
Genbank
NM_016131.4
Species
Human
Sequence of Insert
GGATCCATGGCGAAGAAGACGTACGACCTGCTTTTCAAGCTGCTCCTGATCGGGGATTCCGGAGTGGGGAAGACCTGCGTCCTTTTTCGTTTTTCGGATGATGCCTTCAATACTACCTTTATTTCCACCATAGGAATAGACTTCAAGATCAAAACAGTTGAATTACAAGGAAAGAAGATCAAGCTACAGATATGGGATACAGCAGGCCAGGAGCGATTTCACACCATCACAACCTCCTACTACAGAGGCGCAATGGGTATCATGCTAGTATATGACATCACCAATGGTAAAAGTTTTGAAAACATCAGCAAATGGCTTAGAAACATAGATGAGCATGCCAATGAAGATGTGGAAAGAATGTTACTAGGAAACAAGTGTGATATGGACGACAAAAGAGTTGTACCTAAAGGAAAAGGAGAACAGATTGCAAGGGAGCATGGTATTAGGTTTTTTGAGACTAGTGCAAAAGCAAATATAAACATCGAAAAGGCGTTCCTCACGTTAGCTGAAGATATCCTTCGAAAGACCCCTGTAAAAGAGCCCAACAGTGAAAATGTAGATATCAGCAGTGGAGGAGGCGTGACAGGCTGGAAGAGCAAATGCTGCTGAGCGGCCGCT
Amino Acid Sequence
MAKKTYDLLFKLLLIGDSGVGKTCVLFRFSDDAFNTTFISTIGIDFKIKTVELQGKKIKLQIWDTAGQERFHTITTSYYRGAMGIMLVYDITNGKSFENISKWLRNIDEHANEDVERMLLGNKCDMDDKRVVPKGKGEQIAREHGIRFFETSAKANINIEKAFLTLAEDILRKTPVKEPNSENVDISSGGGVTGWKSKCC*
Vector Type
Mammalian
Antibiotic
Amp
100042 R 1000 1001 1047 19007
Enquire Now