Rab12 (mouse)

Plasmid
pMK-RQ RAb12 (mouse)
Parent Plasmid
pMK-RQ
DU Number
DU51756
Species
Mouse
Sequence of Insert
GAATTCATGGATCCCAGCGCCGCGCTGCACCGGCGGCCCGCGGGCGGCAGCCTGGGCGCGGTCTCCCCGGCGCTGTCGGGCGGCCAGGCCCGCCGGAGGAAGCAGCCCCCCAGGCCGGCCGACTTCAAGCTGCAGGTCATCATCATCGGCTCCCGCGGCGTGGGCAAGACCAGCCTGATGGAGCGCTTCACCGACGACACGTTCTGCGAGGCCTGCAAGTCCACCGTGGGTGTTGACTTTAAAATCAAGACTGTAGAACTAAGAGGGAAGAAAATTAGATTACAGATCTGGGACACAGCAGGGCAGGAGCGATTTAACAGCATTACCTCAGCCTATTACAGAAGTGCCAAGGGGATCATACTCGTATATGACATCACCAAGAAGGAGACGTTCGATGACTTGCCAAAGTGGATGAAGATGATTGACAAGTATGCTTCAGAAGACGCCGAGCTCCTCCTGGTTGGAAATAAGCTGGACTGTGAGACAGACAGAGAAATCTCAAGGCAGCAAGGAGAAAAGTTTGCACAGCAGATAACCGGGATGCGCTTCTGCGAAGCCAGTGCCAAGGACAATTTCAATGTGGACGAGATCTTTCTGAAACTTGTTGATGATATTCTGAAAAAGATGCCTCTTGATGTTTTGAGAAACGAGTTATCCAATAGCATCCTTTCTCTACAACCAGAGCCTGAGATCCCACCAGAGCTGCCTCCTCCCAGACCACACGTCCGATGCTGTTGAGCGGCCGC
Antibiotic
Kan
100042 R 1000 1001 1047 19007
Enquire Now