RAB43

Synonyms
RAB11B, RAB41
Plasmid
pX335 RAB43 ex1 KO antisense
Parent Plasmid
pX335
Expressed
RAB43 ex1 KO antisense guide + Cas9n
DU Number
DU54350
Genbank
ENSG00000172780
Species
Human
Sequence of Insert
GCCTGTTCAAGCTGGTGCTGG
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR KO guide targeting exon 1, use in conjunction with 54344.
100042 R 1000 1001 1047 19007
Enquire Now