RAB43

Synonyms
RAB11B, RAB41
Plasmid
pBABED P U6 RAB43 ex1 KO sense
Parent Plasmid
pBABED P U6
Expressed
RAB43 ex1 KO sense guide
DU Number
DU54344
Genbank
ENSG00000172780
Species
Human
Sequence of Insert
GACTGCTCGTCCGGGTCCCCC
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR KO guide targeting exon 1, use in conjunction with 54350.
100042 R 1000 1001 1047 19007
Enquire Now