RAB8A

Synonyms
MEL, RAB8
Plasmid
pCMV Cas9hf1 2AP RAB8A KO sense + RAB8B KO sense
Parent Plasmid
pCMV Cas9hf1 Puro U6
Expressed
RAB8A KO sense + RAB8B KO sense + Cas9hf1 + Puro
DU Number
DU54323
Genbank
ENSG00000167461
Species
Human
Sequence of Insert
GTGTTCAAGCTGCTGCTGATC
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR single vector system targeting RAB8A exon 1 and RAB8B exon 1. Expresses all necessary components including High Fidelity Cas9 and Puro for selection.
100042 R 1000 1001 1047 19007
Enquire Now