RAB8B

Plasmid
pX335 RAB8B ex3 KO antisense
Parent Plasmid
pX335
Expressed
RAB8B ex3 KO antisense guide + Cas9 D10A
DU Number
DU52778
Genbank
ENSG00000166128
Species
Human
Sequence of Insert
GAGTACGCTGTCGTGATTGTT
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR KO guide targeting exon 3, use in conjunction with 52764.
100042 R 1000 1001 1047 19007
Enquire Now