RAB8B

Plasmid
pX335 RAB8B ex1 KO antisense C
Parent Plasmid
pX335
Expressed
RAB8B ex1 KO antisense guide C + Cas9dn
DU Number
DU52777
Genbank
ENSG00000166128
Species
Human
Sequence of Insert
GCCCCCGAGTCGCCGATCAGC
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR KO guide targeting exon 1, use in conjunction with 52763.
100042 R 1000 1001 1047 19007
Enquire Now