RAB8A

Synonyms
MEL, RAB8
Plasmid
pCMV5D RAB8A GFP IRES HA donor
Parent Plasmid
pCMV5D
DU Number
DU52775
Genbank
NM_005370.4
Species
Human
Sequence of Insert
GTCGACTCGAGCGGCCGCACACCCGCCCCAACTACTGGCGTGCGCCCTCTGCTGTCGCCTAACGGAACTCCGGGCGCGCGTGCGCACGCACCCCAAGCCACGCCCCGCCAGGCTGCCGGCGCGCGAGCGGTTGGCGCCGCTCCCTGCCTTCCCTCTCCTACAGTGGGGCGGGGCCGGGCCGCCCGAGTCGGGGGTGGAAGGCGGGGGCCACATAATGCCACGCCCCCGCCTCGTCCCCATTTGAAGCCCCGCGACTCTTCACTGCTGGTCAATCAGAGCCCGTGCTCTCCCTAGTGCCGGCCAATGGGAGGTGCGCTCGGGCTGCTTCCGGCTCCGCGCTCCGCTCGCCCCCTCCCAAGGTCTCCCCGCGACTGGCGGGACGCAGGGGCGGGCGTCGGCCGCGGTGACGCGCAGCGGGCCTGGAGCCAATAAGGGGCGGGCTCGGTGCTGATGGACGGTGCTGGTGGCCAGTGGAGAGGCGCTGGCCGCACTTCCAGTCGGGGAGAGAGTGTAATATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAGGTACCGCGGGCCCGAGATCTGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCATGTACCCATACGATGTGCCAGATTACGCCGCGAAGACATATGATTACTTATTCAAGCTACTATTAATTGGTGACAGTGGTGTAGGTAAGACCTGTGTCCTGTTCCGCTTCTCCGAGGACGCCTTCAACTCCACTTTTATCTCCACCATAGGTAACGGGACCGGGGAATGGCTGGGGGCGCCGGAGGCCCGGGCTGGGCGCGCCCCTGAGGGGCTGGGGCTGAGGGATCTACAGGGCTGGACGGGCCGAGGGCGCTGAGAGGGTCGAGGGGGCCTAAAGGGAGAAGAGCAGTCGCCTGCACCGCCGTTCGGGGGTTCCTGGGCCGTGGTGGGGGAGACCAGGTGCCCATTTTGCAGATAGGGAGACTGAGGCTCCGACCCTCAGCCCGCTCGTTAGGGCGTGTTATGTCTTGGGCTGGGGTCTTCGCGCCCGTCCTCTCGATCTGTCCTAGCAGCAGCCCTCGAAGCGGTTCTTTTGAGGCTCTTGCCTTACAGAAGTGGAAACTGAGTCATGGGGAATTGGCCATGGGAAAAAGACAGTGGCATCTCACCTTAATGAGCATTTACTATGTGCCAAGTGCTTCACGTGCGGCCGCTCGAG



Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR donor plasmid. Designed to KI an HA tag at the N-terminus along with a separate GFP product to allow for sorting. Use in conjunction with guides 52654 and 52679.
100042 R 1000 1001 1047 19007
Enquire Now