RAB8B

Plasmid
pBABED P U6 RAB8B ex3 KO sense
Parent Plasmid
pBABED P U6
Expressed
RAB8B ex3 KO sense guide
DU Number
DU52764
Genbank
ENSG00000166128
Species
Human
Sequence of Insert
GAGCGTACTACAGAGGAGCCA
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR KO guide targeting exon 3, use in conjunction with 52778.
100042 R 1000 1001 1047 19007
Enquire Now