RAB8B

Plasmid
pBABED P U6 RAB8B ex1 KO sense C
Parent Plasmid
pBABED P U6
Expressed
RAB8B ex1 KO sense guide C
DU Number
DU52763
Genbank
ENSG00000166128
Species
Human
Sequence of Insert
GCCTCCTGTTCCGCTTCTCAG
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR KO guide targeting exon 1, use in conjunction with 52777.
100042 R 1000 1001 1047 19007
Enquire Now