RAB8A

Synonyms
MEL, RAB8
Plasmid
pX335 RAB8A Nter KI antisense
Parent Plasmid
pX335
Expressed
RAB8A Nter KI antisense guide + cas9 D10A
DU Number
DU52679
Genbank
ENSG00000167461
Species
Human
Sequence of Insert
GATATTACACTCTCTCCCCGA
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR Nter KI guide, use in conjunction with 52654 and a suitable donor.
100042 R 1000 1001 1047 19007
Enquire Now