RAB8A

Synonyms
MEL, RAB8
Plasmid
pBABED P U6 RAB8A Nter KI sense
Parent Plasmid
pBABED P U6
Expressed
RAB8A Nter KI sense guide
DU Number
DU52654
Genbank
ENSG00000167461
Species
Human
Sequence of Insert
GTGTTCAAGCTGCTGCTGATC
Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR Nter KI guide, use in conjunction with 52679 and a suitable donor.
100042 R 1000 1001 1047 19007
Enquire Now