RAB8A

Synonyms
MEL, RAB8
Plasmid
pCMV5D RAB8A Nter HA donor prot guide set 2
Parent Plasmid
pCMV5D
DU Number
DU52617
Genbank
NM_005370.4
Species
Human
Sequence of Insert
GCGGCCGCACACCCGCCCCAACTACTGGCGTGCGCCCTCTGCTGTCGCCTAACGGAACTCCGGGCGCGCGTGCGCACGCACCCCAAGCCACGCCCCGCCAGGCTGCCGGCGCGCGAGCGGTTGGCGCCGCTCCCTGCCTTCCCTCTCCTACAGTGGGGCGGGGCCGGGCCGCCCGAGTCGGGGGTGGAAGGCGGGGGCCACATAATGCCACGCCCCCGCCTCGTCCCCATTTGAAGCCCCGCGACTCTTCACTGCTGGTCAATCAGAGCCCGTGCTCTCCCTAGTGCCGGCCAATGGGAGGTGCGCTCGGGCTGCTTCCGGCTCCGCGCTCCGCTCGCCCCCTCCCAAGGTCTCCCCGCGACTGGCGGGACGCAGGGGCGGGCGTCGGCCGCGGTGACGCGCAGCGGGCCTGGAGCCAATAAGGGGCGGGCTCGGTGCTGATGGACGGTGCTGGTGGCCAGTGGAGAGGCGCTGGCCGCACTTCCCGTCGGGGAGAGAGTGTAATATGTACCCATACGATGTGCCAGATTACGCCGCGAAGACATATGATTACTTATTCAAGCTACTATTAATTGGTGACAGTGGTGTAGGTAAGACCTGTGTCCTGTTCCGCTTCTCCGAGGACGCCTTCAACTCCACTTTTATCTCCACCATAGGTAACGGGACCGGGGAATGGCTGGGGGCGCCGGAGGCCCGGGCTGGGCGCGCCCCTGAGGGGCTGGGGCTGAGGGATCTACAGGGCTGGACGGGCCGAGGGCGCTGAGAGGGTCGAGGGGGCCTAAAGGGAGAAGAGCAGTCGCCTGCACCGCCGTTCGGGGGTTCCTGGGCCGTGGTGGGGGAGACCAGGTGCCCATTTTGCAGATAGGGAGACTGAGGCTCCGACCCTCAGCCCGCTCGTTAGGGCGTGTTATGTCTTGGGCTGGGGTCTTCGCGCCCGTCCTCTCGATCTGTCCTAGCAGCAGCCCTCGAAGCGGTTCTTTTGAGGCTCTTGCCTTACAGAAGTGGAAACTGAGTCATGGGGAATTGGCCATGGGAAAAAGACAGTGGCATCTCACCTTAATGAGCATTTACTATGTGCCAAGTGCTTCACGTGCGGCCGC

Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR Nter HA KI donor, use in conjunction with guides 52654 and 52679. This fragment has been modified to protect against the new guide pair.
100042 R 1000 1001 1047 19007
Enquire Now