rab38

Plasmid
pSC-b Rab38
Parent Plasmid
pSC-B
DU Number
DU51368
Genbank
NM_022337.2
Species
Human
Sequence of Insert
GGATCCATGCAGGCCCCGCACAAGGAGCACCTGTACAAGTTGCTGGTGATTGGCGACCTGGGCGTGGGGAAGACCAGTATCATCAAGCGCTACGTGCACC
AGAACTTCTCTTCGCACTACCGGGCCACAATCGGCGTGGACTTCGCGCTCAAGGTGCTCCACTGGGACCCGGAGACTGTGGTGCGCCTGCAGCTCTGGGA
TATCGCAGGTCAAGAAAGATTTGGAAACATGACGAGGGTCTATTACCGAGAAGCTATGGGTGCATTTATTGTCTTCGATGTCACCAGGCCAGCCACATTT
GAAGCAGTGGCAAAGTGGAAAAATGATTTGGACTCCAAGTTAAGTCTCCCTAATGGCAAACCGGTTTCAGTGGTTTTGTTGGCCAACAAATGTGACCAGG
GGAAGGATGTGCTCATGAACAATGGCCTCAAGATGGACCAGTTCTGCAAGGAGCACGGTTTCGTAGGATGGTTTGAAACATCAGCAAAGGAAAATATAAA
CATTGATGAAGCCTCCAGATGCCTGGTGAAACACATACTTGCAAATGAGTGTGACCTAATGGAGTCTATTGAGCCGGACGTCGTGAAGCCCCATCTCACA
TCAACCAAGGTTGCCAGCTGCTCTGGCTGTGCCAAATCCTAGGCGGCCGC
Vector Type
Other
Antibiotic
Amp; Kan
100042 R 1000 1001 1047 19007
Enquire Now