RAB1B

Plasmid
pX335 RAB1B Nter KI antisense
Parent Plasmid
pX335
Expressed
RAB1B Nter KI antisense guide + Cas9 D10A
DU Number
DU48952
Genbank
NM_030981.2
Species
Human
Sequence of Insert
GGCGGGGCTCACTCACTATT

Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR guide plasmid. Targets antisense of exon 1, designed to KI an HA tag to the N-terminus of RAB1B when co-transfected with sense guide 48938 and donor 48991. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.
100042 R 1000 1001 1047 19007
Enquire Now