RAB1A

Synonyms
RAB1, YPT1
Plasmid
pX335 RAB1A KO antisense
Parent Plasmid
pX335
Expressed
RAB1A KO antisense guide + Cas9 D10A
DU Number
DU48945
Genbank
NM_004161.4
Species
Human
Sequence of Insert
GTATATGTATCATCCTGAAG

Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR guide plasmid. Targets antisense strand of exon 1, designed to KO RAB1A when co-transfected with sense guide 48931. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.
100042 R 1000 1001 1047 19007
Enquire Now