RAB1A

Synonyms
RAB1, YPT1
Plasmid
pBABED P U6 RAB1A KO sense
Parent Plasmid
pBABED P U6
Expressed
RAB1A KO sense guide
DU Number
DU48931
Genbank
NM_004161.4
Species
Human
Sequence of Insert
GCTACATCAGCACAATTGGTG


Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR guide plasmid. Targets sense strand of exon 1, designed to KO RAB1A when co-transfected with antisense guide 48945. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.
100042 R 1000 1001 1047 19007
Enquire Now