RAB8A

Synonyms
MEL, RAB8
Plasmid
pBABED P U6 RAB8A KO sense
Parent Plasmid
pBABED P U6
Expressed
RAB8A KO sense guide
DU Number
DU48928
Genbank
NM_005370.4
Species
Human
Sequence of Insert
GTGTTCAAGCTGCTGCTGATC

Vector Type
Mammalian
Antibiotic
Amp
Comments
CRISPR guide plasmid. Targets sense strand of exon 1, designed to KO RAB8A when co-transfected with antisense guide 48942. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.
100042 R 1000 1001 1047 19007
Enquire Now