Rab43

Synonyms
RAB11B; RAB41
Plasmid
pSC-B Rab43 (B/N)
Parent Plasmid
pSC-B
DU Number
DU50316
Genbank
NM_198490.2 GI:325910889
Species
Human
Sequence of Insert
GGATCCATGGCAGGGCCGGGCCCAGGCCCGGGGGACCCGGACGAGCAGTACGATTTCCTGTTCAAGCTGGTGCTGGTGGGCGACGCAAGCGTGGGCAAGACGTGCGTGGTGCAGCGCTTCAAGACCGGCGCCTTCTCGGAGCGCCAGGGAAGCACCATCGGCGTCGACTTCACCATGAAGACGCTGGAGATCCAGGGCAAGCGGGTCAAGCTGCAGATCTGGGACACGGCCGGCCAGGAGCGGTTCCGCACCATCACCCAGAGCTACTACCGCAGTGCCAATGGGGCCATCCTTGCCTACGACATCACCAAGAGGAGCTCCTTCCTGTCGGTGCCTCACTGGATTGAGGATGTGAGGAAGTATGCGGGCTCCAACATTGTGCAGCTGCTGATCGGGAACAAGTCAGACCTCAGCGAGCTTCGGGAGGTCTCCTTGGCTGAGGCACAGAGCCTGGCTGAGCACTATGACATCCTGTGTGCCATTGAGACGTCTGCCAAGGACTCGAGCAACGTGGAGGAGGCCTTCCTGAGGGTGGCCACGGAGCTCATCATGCGGCACGGGGGCCCCTTGTTCAGCGAGAAGAGCCCCGACCACATCCAGCTGAACAGCAAGGACATCGGAGAAGGCTGGGGCTGCGGGTGCTGAGCGGCCGC
Vector Type
Other
Antibiotic
Amp; Kan
100042 R 1000 1001 1047 19007
Enquire Now