RAB3IP

Plasmid
pCMV5D GFP Rab3IP
Parent Plasmid
pCMV5D GFP
Expressed
GFP-RAB3IP
DU Number
DU26107
Genbank
NM_175623.3
Tag
GFP
Species
Human
Sequence of Insert
ATGGGATTAAAAAAGATGAAAGGGTTATCTTATGATGAGGCTTTTGCTATGGCTAATGATCCCTTGGAAGGCTTCCATGAAGTAAACCTTGCTTCACCTACTTCTCCGGACCTTCTTGGTGTGTATGAATCAGGAACTCAAGAGCAGACTACCTCACCAAGTGTCATCTACCGGCCACACCCTTCAGCTTTATCCTCTGTACCTATCCAGGCAAATGCATTAGATGTTTCTGAACTTCCTACACAACCCGTGTATTCATCCCCCAGACGTTTAAATTGTGCGGAAATATCTAGTATCAGCTTTCATGTTACAGACCCAGCCCCTTGCTCTACCTCTGGAGTCACAGCTGGATTAACTAAATTAACTACAAGAAAGGACAACTATAATGCAGAGAGAGAGTTTTTACAGGGTGCTACTATAACAGAGGCTTGCGATGGCAGTGATGATATTTTTGGGTTGAGTACTGATAGTCTGTCTCGTTTACGAAGCCCATCTGTTTTGGAAGTTAGAGAAAAGGGCTATGAACGATTAAAAGAAGAACTCGCAAAAGCTCAGAGGGAACTGAAGTTAAAAGATGAAGAATGTGAGAGGCTTTCAAAAGTGCGAGATCAACTTGGACAGGAATTGGAAGAACTCACAGCTAGTCTATTTGAGGAAGCTCATAAAATGGTGAGAGAAGCAAATATCAAGCAGGCAACAGCAGAAAAACAGCTAAAAGAAGCACAAGGAAAAATTGATGTACTTCAAGCTGAAGTAGCTGCATTGAAGACACTTGTATTGTCCAGTTCTCCAACATCACCTACGCAGGAGCCTTTGCCAGGTGGAAAGACACCTTTTAAAAAGGGGCATACAAGAAATAAAAGCACAAGCAGTGCTATGAGTGGCAGTCATCAGGACCTCAGTGTGATACAGCCAATTGTAAAAGACTGCAAAGAGGCTGACTTATCCTTGTATAATGAATTCCGATTGTGGAAGGATGAGCCCACAATGGACAGGACGTGTCCTTTCTTAGACAAAATCTACCAGGAAGATATCTTTCCATGTTTAACATTCTCAAAAAGTGAGTTGGCTTCAGCTGTTCTGGAGGCTGTGGAAAACAATACTCTAAGCATTGAACCAGTGGGATTACAACCTATCCGGTTTGTGAAAGCTTCTGCAGTTGAATGCGGAGGACCAAAAAAATGTGCTCTCACTGGCCAGAGTAAGTCCTGTAAACACAGAATTAAATTAGGGGACTCAAGCAACTATTATTATATTTCTCCTTTTTGCAGATACAGGATCACTTCTGTATGTAACTTTTTTACATACATTCGATACATTCAGCAGGGACTCGTGAAACAGCAGGATGTTGATCAGATGTTTTGGGAGGTTATGCAGTTGAGAAAAGAGATGTCATTGGCAAAGCTGGGTTATTTCAAAGAGGAACTCTGA
Amino Acid Sequence
MVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKVNFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYKGSMGLKKMKGLSYDEAFAMANDPLEGFHEVNLASPTSPDLLGVYESGTQEQTTSPSVIYRPHPSALSSVPIQANALDVSELPTQPVYSSPRRLNCAEISSISFHVTDPAPCSTSGVTAGLTKLTTRKDNYNAEREFLQGATITEACDGSDDIFGLSTDSLSRLRSPSVLEVREKGYERLKEELAKAQRELKLKDEECERLSKVRDQLGQELEELTASLFEEAHKMVREANIKQATAEKQLKEAQGKIDVLQAEVAALKTLVLSSSPTSPTQEPLPGGKTPFKKGHTRNKSTSSAMSGSHQDLSVIQPIVKDCKEADLSLYNEFRLWKDEPTMDRTCPFLDKIYQEDIFPCLTFSKSELASAVLEAVENNTLSIEPVGLQPIRFVKASAVECGGPKKCALTGQSKSCKHRIKLGDSSNYYYISPFCRYRITSVCNFFTYIRYIQQGLVKQQDVDQMFWEVMQLRKEMSLAKLGYFKEEL*
Vector Type
Mammalian
Antibiotic
Amp
Comments
Isoform Alpha 2
100042 R 1000 1001 1047 19007
Enquire Now