RAB3IP

Plasmid
pET15b 6HIS SUMO Rab3IP
Parent Plasmid
pET15b 6His SUMO
Expressed
6His SUMO RAB3IP
DU Number
DU26095
Genbank
NM_175623.3
Tag
6His
SUMO
Species
Human
Sequence of Insert
GGATCCATGGGATTAAAAAAGATGAAAGGGTTATCTTATGATGAGGCTTTTGCTATGGCTAATGATCCCTTGGAAGGCTTCCATGAAGTAAACCTTGCTTCACCTACTTCTCCGGACCTTCTTGGTGTGTATGAATCAGGAACTCAAGAGCAGACTACCTCACCAAGTGTCATCTACCGGCCACACCCTTCAGCTTTATCCTCTGTACCTATCCAGGCAAATGCATTAGATGTTTCTGAACTTCCTACACAACCCGTGTATTCATCCCCCAGACGTTTAAATTGTGCGGAAATATCTAGTATCAGCTTTCATGTTACAGACCCAGCCCCTTGCTCTACCTCTGGAGTCACAGCTGGATTAACTAAATTAACTACAAGAAAGGACAACTATAATGCAGAGAGAGAGTTTTTACAGGGTGCTACTATAACAGAGGCTTGCGATGGCAGTGATGATATTTTTGGGTTGAGTACTGATAGTCTGTCTCGTTTACGAAGCCCATCTGTTTTGGAAGTTAGAGAAAAGGGCTATGAACGATTAAAAGAAGAACTCGCAAAAGCTCAGAGGGAACTGAAGTTAAAAGATGAAGAATGTGAGAGGCTTTCAAAAGTGCGAGATCAACTTGGACAGGAATTGGAAGAACTCACAGCTAGTCTATTTGAGGAAGCTCATAAAATGGTGAGAGAAGCAAATATCAAGCAGGCAACAGCAGAAAAACAGCTAAAAGAAGCACAAGGAAAAATTGATGTACTTCAAGCTGAAGTAGCTGCATTGAAGACACTTGTATTGTCCAGTTCTCCAACATCACCTACGCAGGAGCCTTTGCCAGGTGGAAAGACACCTTTTAAAAAGGGGCATACAAGAAATAAAAGCACAAGCAGTGCTATGAGTGGCAGTCATCAGGACCTCAGTGTGATACAGCCAATTGTAAAAGACTGCAAAGAGGCTGACTTATCCTTGTATAATGAATTCCGATTGTGGAAGGATGAGCCCACAATGGACAGGACGTGTCCTTTCTTAGACAAAATCTACCAGGAAGATATCTTTCCATGTTTAACATTCTCAAAAAGTGAGTTGGCTTCAGCTGTTCTGGAGGCTGTGGAAAACAATACTCTAAGCATTGAACCAGTGGGATTACAACCTATCCGGTTTGTGAAAGCTTCTGCAGTTGAATGCGGAGGACCAAAAAAATGTGCTCTCACTGGCCAGAGTAAGTCCTGTAAACACAGAATTAAATTAGGGGACTCAAGCAACTATTATTATATTTCTCCTTTTTGCAGATACAGGATCACTTCTGTATGTAACTTTTTTACATACATTCGATACATTCAGCAGGGACTCGTGAAACAGCAGGATGTTGATCAGATGTTTTGGGAGGTTATGCAGTTGAGAAAAGAGATGTCATTGGCAAAGCTGGGTTATTTCAAAGAGGAACTCTGAGCGGCCGC
Amino Acid Sequence
MGHHHHHHSDQEAKPSTEDLGDKKEGEYIKLKVIGQDSSEIHFKVKMTTHLKKLKESYCQRQGVPMNSLRFLFEGQRIADNHTPKELGMEEEDVIEVYQEQTGGSMGLKKMKGLSYDEAFAMANDPLEGFHEVNLASPTSPDLLGVYESGTQEQTTSPSVIYRPHPSALSSVPIQANALDVSELPTQPVYSSPRRLNCAEISSISFHVTDPAPCSTSGVTAGLTKLTTRKDNYNAEREFLQGATITEACDGSDDIFGLSTDSLSRLRSPSVLEVREKGYERLKEELAKAQRELKLKDEECERLSKVRDQLGQELEELTASLFEEAHKMVREANIKQATAEKQLKEAQGKIDVLQAEVAALKTLVLSSSPTSPTQEPLPGGKTPFKKGHTRNKSTSSAMSGSHQDLSVIQPIVKDCKEADLSLYNEFRLWKDEPTMDRTCPFLDKIYQEDIFPCLTFSKSELASAVLEAVENNTLSIEPVGLQPIRFVKASAVECGGPKKCALTGQSKSCKHRIKLGDSSNYYYISPFCRYRITSVCNFFTYIRYIQQGLVKQQDVDQMFWEVMQLRKEMSLAKLGYFKEEL*
Vector Type
Bacterial
Antibiotic
Amp
Comments
Isoform Alpha 2. Linker after SENP cleavage needs deleted
100042 R 1000 1001 1047 19007
Enquire Now