RAB3IP

Plasmid
pSC-B Rab3IP
Parent Plasmid
pSC-B
DU Number
DU26080
Genbank
NM_175623.3
Species
Human
Sequence of Insert
ATGGGATTAAAAAAGATGAAAGGGTTATCTTATGATGAGGCTTTTGCTATGGCTAATGATCCCTTGGAAGGCTTCCATGAAGTAAACCTTGCTTCACCTACTTCTCCGGACCTTCTTGGTGTGTATGAATCAGGAACTCAAGAGCAGACTACCTCACCAAGTGTCATCTACCGGCCACACCCTTCAGCTTTATCCTCTGTACCTATCCAGGCAAATGCATTAGATGTTTCTGAACTTCCTACACAACCCGTGTATTCATCCCCCAGACGTTTAAATTGTGCGGAAATATCTAGTATCAGCTTTCATGTTACAGACCCAGCCCCTTGCTCTACCTCTGGAGTCACAGCTGGATTAACTAAATTAACTACAAGAAAGGACAACTATAATGCAGAGAGAGAGTTTTTACAGGGTGCTACTATAACAGAGGCTTGCGATGGCAGTGATGATATTTTTGGGTTGAGTACTGATAGTCTGTCTCGTTTACGAAGCCCATCTGTTTTGGAAGTTAGAGAAAAGGGCTATGAACGATTAAAAGAAGAACTCGCAAAAGCTCAGAGGGAACTGAAGTTAAAAGATGAAGAATGTGAGAGGCTTTCAAAAGTGCGAGATCAACTTGGACAGGAATTGGAAGAACTCACAGCTAGTCTATTTGAGGAAGCTCATAAAATGGTGAGAGAAGCAAATATCAAGCAGGCAACAGCAGAAAAACAGCTAAAAGAAGCACAAGGAAAAATTGATGTACTTCAAGCTGAAGTAGCTGCATTGAAGACACTTGTATTGTCCAGTTCTCCAACATCACCTACGCAGGAGCCTTTGCCAGGTGGAAAGACACCTTTTAAAAAGGGGCATACAAGAAATAAAAGCACAAGCAGTGCTATGAGTGGCAGTCATCAGGACCTCAGTGTGATACAGCCAATTGTAAAAGACTGCAAAGAGGCTGACTTATCCTTGTATAATGAATTCCGATTGTGGAAGGATGAGCCCACAATGGACAGGACGTGTCCTTTCTTAGACAAAATCTACCAGGAAGATATCTTTCCATGTTTAACATTCTCAAAAAGTGAGTTGGCTTCAGCTGTTCTGGAGGCTGTGGAAAACAATACTCTAAGCATTGAACCAGTGGGATTACAACCTATCCGGTTTGTGAAAGCTTCTGCAGTTGAATGCGGAGGACCAAAAAAATGTGCTCTCACTGGCCAGAGTAAGTCCTGTAAACACAGAATTAAATTAGGGGACTCAAGCAACTATTATTATATTTCTCCTTTTTGCAGATACAGGATCACTTCTGTATGTAACTTTTTTACATACATTCGATACATTCAGCAGGGACTCGTGAAACAGCAGGATGTTGATCAGATGTTTTGGGAGGTTATGCAGTTGAGAAAAGAGATGTCATTGGCAAAGCTGGGTTATTTCAAAGAGGAACTCTGA
Amino Acid Sequence
MGLKKMKGLSYDEAFAMANDPLEGFHEVNLASPTSPDLLGVYESGTQEQTTSPSVIYRPHPSALSSVPIQANALDVSELPTQPVYSSPRRLNCAEISSISFHVTDPAPCSTSGVTAGLTKLTTRKDNYNAEREFLQGATITEACDGSDDIFGLSTDSLSRLRSPSVLEVREKGYERLKEELAKAQRELKLKDEECERLSKVRDQLGQELEELTASLFEEAHKMVREANIKQATAEKQLKEAQGKIDVLQAEVAALKTLVLSSSPTSPTQEPLPGGKTPFKKGHTRNKSTSSAMSGSHQDLSVIQPIVKDCKEADLSLYNEFRLWKDEPTMDRTCPFLDKIYQEDIFPCLTFSKSELASAVLEAVENNTLSIEPVGLQPIRFVKASAVECGGPKKCALTGQSKSCKHRIKLGDSSNYYYISPFCRYRITSVCNFFTYIRYIQQGLVKQQDVDQMFWEVMQLRKEMSLAKLGYFKEEL*
Vector Type
Other
Antibiotic
Amp; Kan
Comments
Isoform Alpha 2
100042 R 1000 1001 1047 19007
Enquire Now