RAB39B

Plasmid
pSC-b RAB39b
Parent Plasmid
pSC-B
DU Number
DU43828
Genbank
Q96DA2
Species
Human
Sequence of Insert
GGATCCatggaggccatctggctgtaccagttccggctcattgtcatcgg
ggattccacagtgggcaagtcctgcctgatccgccgcttcaccgagggtc
gctttgcccaggtttctgaccccaccgtgggggtggattttttctcccgc
ttggtggagatcgagccaggaaaacgcatcaagctccagatctgggatac
cgcgggtcaagagaggttcagatccatcactcgcgcctactacaggaact
cagtaggtggtcttctcttatttgacattaccaaccgcaggtccttccag
aatgtccatgagtggttagaagagaccaaagtacacgttcagccctacca
aattgtatttgttctggtgggtcacaagtgtgacctggatacacagaggc
aagtgactcgccacgaggccgagaaactggctgctgcatacggcatgaag
tacattgaaacgtcagcccgagatgccattaatgtggagaaagccttcac
agacctgacaagagacatatatgagctggttaaaaggggggagattacaa
tccaggagggctgggaaggggtgaagagtggatttgtaccaaatgtggtt
cactcttcagaagaggttgtcaaatcagagaggagatgtttgtgctaggc
ggccgc
Vector Type
Other
Antibiotic
Amp; Kan
100042 R 1000 1001 1047 19007
Enquire Now