Rab8b

Plasmid
pSC-b rab8b 91-150
Parent Plasmid
pSC-B
DU Number
DU43158
Genbank
Q92930
Species
Human
Sequence of Insert
ggatccacaaatgaaaaatcctttgacaatattaaaaattggatcagaaacattgaagagcatgcctcttccgatgtcgaaagaatgatcctgggtaacaaatgtgatatgaatgacaaaagacaagtgtcaaaagaaagaggggagaagctagcaattgactatgggattaaattcttggagacataagcggccgc
Vector Type
Bacterial
Antibiotic
Amp; Kan
100042 R 1000 1001 1047 19007
Enquire Now