Rab10

Plasmid
pGFPTAP Rab10
Parent Plasmid
pGFP TAP BN
Expressed
GFPTAP Rab10
DU Number
DU16426
Genbank
NM_016131.3 GI:142365829*
Tag
GFP
TAP
Sequence of Insert
GGATCCATGGCGAAGAAGACGTACGACCTGCTTTTCAAGCTGCTCCTGATCGGGGATTCCGGAGTGGGGAAGACCTGCGTCCTTTTTCGTTTTTCGGATGATGCCTTCAATACTACCTTTATTTCCACCATAGGAATAGACTTCAAGATCAAAACAGTTGAATTACAAGGAAAGAAGATCAAGCTACAGATATGGGATACAGCAGGCCAGGAGCGATTTCACACCATCACAACCTCCTACTACAGAGGCGCAATGGGTATCATGCTAGTATATGACATCACCAATGGTAAAAGTTTTGAAAACATC
AGCAAATGGCTTAGAAACATAGATGAGCATGCCAATGAAGATGTGGAAAG
AATGTTACTAGGAAACAAGTGTGATATGGACGACAAAAGAGTTGTACCTA
AAGGAAAAGGAGAACAGATTGCAAGGGAGCATGGTATTAGGTTTTTTGAG
ACTAGTGCAAAAGCAAATATAAACATCGAAAAGGCGTTCCTCACGTTAGC
TGAAGATATCCTTCGAAAGACCCCTGTAAAAGAGCCCAACAGTGAAAATG
TAGATATCAGCAGTGGAGGAGGCGTGACAGGCTGGAAGAGCAAATGCTGC
TGAGCGGCCGC
Amino Acid Sequence
MVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKVNFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYKSGRTQISSSSFDIALATMDTSAHDEAVDNKFNKEQQNAFYEILHLPNLNEEQRNAFIQSLKDDPSQSANLLAEAKKLNDAQAPKVDNKFNKERQNAFYEILHLPNLNEEQRNAFIQSLKDDPSQSANLLAEAKKLNDAQAPKVDASWSAGASENLYFQGGRSMEKRRWKKNFIAVSAANRFKKISSSGALDYDIPTALEVLFQGPLGSMAKKTYDLLFKLLLIGDSGVGKTCVLFRFSDDAFNTTFISTIGIDFKIKTVELQGKKIKLQIWDTAGQERFHTITTSYYRGAMGIMLVYDITNGKSFENISKWLRNIDEHANEDVERMLLGNKCDMDDKRVVPKGKGEQIAREHGIRFFETSAKANINIEKAFLTLAEDILRKTPVKEPNSENVDISSGGGVTGWKSKCC*

Vector Type
Mammalian
Antibiotic
Kan
Comments
Sequence differences compared with NM_016131.3 CDS:
g360a (silent), g413a (G138E- present in many other published RNAs)
100042 R 1000 1001 1047 19007
Enquire Now